Lab 2: PROCEDURE Part 1
PROCEDURE: PCR
Note: This is the first of several “simulated labs” focused on studying HCAII. The protocols for these labs are written as though you were doing the lab in person, and they include every step that would be required to do so. You are expected to review the protocols before coming to lab, and will be asked about them on the pre-lab quiz. One of your in-lab activities will be to go through the protocol with a partner, and you will have a chance to ask your TAs questions.
Begin by choosing the appropriate primer sets you will need to amplify the HCAII gene and pETblue2 vector. Choose from the primers listed below.
-
- Vector and insert each need to be amplified with overlapping sequence to allow for Gibson assembly (see lecture for more information). If this is done correctly, you will ultimately be able to express his-tagged HCAII protein from your construct. Therefore:
- Your insert forward primer should contain the HCAII start site such that it overlaps with the start site indicated in pETblue2.
- The stop codon in the HCAII gene has to be removed since you want to use the vector’s his-tag and stop codon. You need to keep the 3′ end of HCAII in frame so that the His-tag in the vector will be expressed.
- The map of the vector and the HCAII gene 5′ and 3′ end sequences are provided as a pdf at this link (opens in a new tab): pETblue2 map
- Choose which primers will be used for which reaction before coming to lab. Do your best. When you arrive to lab, you will discuss with a partner.
- Vector and insert each need to be amplified with overlapping sequence to allow for Gibson assembly (see lecture for more information). If this is done correctly, you will ultimately be able to express his-tagged HCAII protein from your construct. Therefore:
Primers available:
Primer A:
5’ GTTTAACTTTAAGAAGGAGATATACCATGGCCCATCACTGGGGGTACGGCAAAC 3’
Primer B:
5’ GAACAGGCAAATCAAAGCTTCCTTCAAACACCACCACCACCACCACTAATGTTAATTAAG 3’
Primer C:
5’ GTTTGCCGTACCCCCAGTGATGGGCCATGGTATATCTCCTTCTTAAAGTTAAAC 3’
Primer D:
5’ CTTAATTAACATTAGTGGTGGTGGTGGTGGTGTTTGAAGGAAGCTTTGATTTGCCTGTTC 3’
Next, calculate the volume of all of the components for the three different reactions you will be running.
This quick video explains how to do the dilution calculations for PCR, and includes some practice problems:
The table below lists each reagent needed for PCR, the stock solutions that you will be provided, and the desired final reaction conditions:
| Reagent | Stock Solutions Provided | Desired Final Reaction Conditions |
| Buffer | 5x | 1x |
| dNTP mix | 10 mM (includes 10 mM of each nucleotide) | 200 μM |
| Template | x ng/μL (actual concentration will be provided in lab) | 10 ng |
| Forward primer | 10 μM | 400 nM |
| Reverse primer | 10 μM | 400 nM |
| Phusion polymerase | 1 U/μL (A “U” or “unit” is a standard way of measuring an amount of enzyme in a solution, and relates to its activity) | 1 U |
| Sterile water | To a final volume of 50 μL |
Use the informa